goscripttm reverse transcription kit (promega usa) (Promega)
90
Structured Review
Promega
goscripttm reverse transcription kit (promega usa)
Goscripttm Reverse Transcription Kit (Promega Usa), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/goscripttm+reverse+transcription+kit+(promega+usa)/goscripttm+reverse+transcription+system/10__5897_slash_ajb2019__16773-79-20-24
Average 90 stars, based on 1 article reviews
Goscripttm Reverse Transcription Kit (Promega Usa), supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/goscripttm+reverse+transcription+kit+(promega+usa)/goscripttm+reverse+transcription+system/10__5897_slash_ajb2019__16773-79-20-24
Average 90 stars, based on 1 article reviews
goscripttm reverse transcription kit (promega usa) - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Reverse Transcription:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: Comparative Gut Proteome of Nyssomyia umbratilis from Leishmaniasis Endemic and Non-Endemic Areas of Amazon Reveals Differences in Microbiota and Proteins Related to Immunity and Gut Function. Article Snippet: The RNAs obtained were diluted in 20 μL of RNase-free water, quantified in NanoDrop and stored at −80 ◦C until use. .. 2.4.4. cDNA Synthesis Reverse transcriptase reactions were carried out using the Article Title: Impacts of particle size and surface charge of ZnO on horizontal transformation of antibiotic resistance genes. Article Snippet: The ever-growing antibiotic resistance in bacteria poses an enormous threat to public health and the environment.. The horizontal transfer of antibiotic resistance genes (ARGs) is a major pathway for disseminating antibiotic resistance.. As an inexpensive, nontoxic, and biocompatible material, ZnO with diverse sizes and surface properties have been prepared for widespread use. Article Title: S100a4 promotes metastatic transformation in non-metastatic liver cancer cells through NMIIa binding: mechanistic insights. Article Snippet: Total RNA was extracted from cells using the QIAwave RNA Mini Kit (74534, QIAGEN) following the manufacturer’s instructions. .. Reverse transcription of total RNA into complementary DNA (cDNA) was performed using the Article Title: Knockdown of Claudin-8 (CLDN8) Indicates a Link Between Breast Cancer Cell Sensitivity to Chemotherapeutics and Reveals a Potential Use of CLDN8 as a Molecular Diagnostic and Target for Therapy. Article Snippet: Total RNA was extracted from the tissue samples and breast cancer cell lines using the TRI Reagent Kit (Merck KGaA, Darmstadt, Germany) according to the manufacturer’s protocol. .. After isolation, RNA concentrations were adjusted to 500 ng/μL, and reverse transcription was performed using the Article Title: Maternal metabolizable energy intake during late gestation affect energy metabolism of the skeletal muscle of beef offspring. Article Snippet: The total RNA was quantified with a NanoDrop spectrophotometer (Thermo Fisher Scientific®, Waltham, MA, USA), ensuring an optimal 260/280 ratio between 1.8 and 2.0, and the integrity was assessed in a 1% agarose gel. .. The RNA samples were reverse transcribed into cDNA using the Article Title: Effect of salt stress on K + /Na + homeostasis, osmotic adjustment, and expression profiles of high-affinity potassium transporter (HKT) genes. Article Snippet: Salt stress is one of the major threats affecting crop yield.. We assessed the behaviour of three barley genotypes, Ardhaoui, Manel, and Testour under 200 mM NaCl with the aim of evaluating the physiological and molecular mechanisms involved in barley salinity tolerance.. Results revealed that salinity stress significantly decreases plant growth and water-holding capacity, particularly in the salt-sensitive genotype Testour. Article Title: Dihydromyricetin May Attenuate Skin Aging as a RAGE Inhibitor. Article Snippet: .. Total RNA was extracted, and reverse transcription was performed using the cDNA Synthesis:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Article Title: Comparative Gut Proteome of Nyssomyia umbratilis from Leishmaniasis Endemic and Non-Endemic Areas of Amazon Reveals Differences in Microbiota and Proteins Related to Immunity and Gut Function. Article Snippet: The RNAs obtained were diluted in 20 μL of RNase-free water, quantified in NanoDrop and stored at −80 ◦C until use. .. 2.4.4. cDNA Synthesis Reverse transcriptase reactions were carried out using the Software:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Polymerase Chain Reaction:Article Title: CITK modulates BRCA1 recruitment at DNA double strand breaks sites through HDAC6 Article Snippet: Control embryos were injected with standard (std) MO (CCTCTTACCTCAGTTACAATTTATA). cita splicing morpholino ( cita -sMO) was validated by RT-PCR starting from total RNA of 24 hpf control and cita -sMO injected embryos (~30 embryos per condition) using the NucleoZOL one-phase RNA purification reagent according to the manufacturer’s instructions (Macherey-Nagel Düren, Germany) as described in [ ]. .. After DNase tratement with RQ1 RNase-Free DNase kit (Promega, Madison, WI, USA) cDNA was synthetyzed using the Isolation:Article Title: Knockdown of Claudin-8 (CLDN8) Indicates a Link Between Breast Cancer Cell Sensitivity to Chemotherapeutics and Reveals a Potential Use of CLDN8 as a Molecular Diagnostic and Target for Therapy. Article Snippet: Total RNA was extracted from the tissue samples and breast cancer cell lines using the TRI Reagent Kit (Merck KGaA, Darmstadt, Germany) according to the manufacturer’s protocol. .. After isolation, RNA concentrations were adjusted to 500 ng/μL, and reverse transcription was performed using the |